You are viewing earlgreytea68
![]() | |
|
Title - Chaos Theory on Dimensionally Stable Objects on Earth College Campuses (13/27-ish) Author - Rating - General Characters - Jack, OCs Spoilers - None Disclaimer - I don't own them and I don't make money off of them, but I don't like to dwell on that, so let's move on. (Except for the kids. They're all mine.) Summary - Brem goes to university. Author's Notes - A big thank-you to Many, many, many thanks to Kristin, for all the ideas. Thanks also to The gorgeous icon was created by I swear to God that someday I will stop having a breakdown and get myself organized. Until that day, another late, drive-by posting for you. 1 - 2 - 3 - 4 - 5 - 6 - 7 - 8 - 9 - 10 - 11 - 12
Chapter Thirteen
Brem was getting nowhere with his column. He had sat and stared at the blinking cursor in the document and typed not a single word. His hands itched for his journal, to write about Kate and Jack and whether he didn’t relax enough but he needed Gallifreyan for all those ideas and right now the idea of forcing English from his fingers was impossible.
His mobile trilled, where he’d set it out on his desk, and he turned it toward him. Kate, it blinked, and he flipped it open. “Hey.”
“How’s your column coming?”
“Not at all.”
“Great. You and I can commiserate later on about writers’ block, then.”
“No, I don’t—Unless you want to go to the library right now, I was hoping we could go to lunch.”
“Need a break?” she guessed.
“Yeah. And I, uh, I’ve got this, kind of, family member in town and he’s insisting on taking us to lunch.”
“A family member?”
“Yeah. Like an uncle, except not really. A godfather, I suppose, if my parents did that sort of thing. The ‘Jack’ that my middle name comes from. He’s here, and he wants to take us to lunch.”
“Oh, Brem!” exclaimed Kate, sounding delighted. “This is fantastic! Is he going to tell me all sorts of stories about you as a baby?”
The thought had never even occurred to Brem. He blinked in horror. “I was a very intelligent, charming, dashing baby,” he said.
Kate laughed. “Where do you want to meet?”
“I’ve got to call Jack. You pick a place, you know this restaurant stuff isn’t my forte.”
“You’ve gotten better.”
“Through a lot of research.”
“Let’s do Border Café.”
“Okay. Where’s that?”
“Brem! We went there on our first date!”
“We…did? The hot chocolate place?”
He heard Kate sigh. “No. We went for Mexican after that, you don’t remember?”
“I don’t remember anything but you from that night.”
There was a pause. “Oh, that was a very good line,” she said.
“It’s not a line,” he protested, confused.
“I know. That’s what makes it so good. I’ll meet you in front of Widener in fifteen minutes.”
“Perfect,” he said, and hung up and rang Jack, who picked up immediately. “How’s your recruiting going?” Brem asked him.
“Oh, great.”
Brem sighed. “Is ‘recruiting’ a euphemism?”
“Possibly,” said Jack, after a moment. “Where are you? We’re meeting Kate in fifteen minutes.”
“Where?”
“In front of Widener. It’s the library.”
“I’ll find you,” said Jack, and hung up.
Brem tucked his mobile into the pocket of his too-dull coat and headed out into the cold. He was the first one to the meeting spot, and Kate came up a few minutes later, once again looking like the most vibrant thing on the brown-and-gray Yard.
“Hi,” she said, and leaned up to brush a kiss over his lips in greeting.
“Hi,” he responded. “Jack’s meeting us here.”
“I can’t wait,” she grinned.
“You look like you’re planning evil things.”
“Never! I never plan evil things!”
Brem lifted an eyebrow at her.
“Hello there,” interjected Jack from out of nowhere, hand already out stretched in Kate’s direction, patented grin already plastered on his face. “Captain Jack Harkness.”
“Stop it,” inserted Brem, warningly.
Kate looked at him in bemusement, then said to Jack, “I’m Kate Bonneville.”
“What a lovely name,” said Jack.
“We’re having Mexican for lunch,” inserted Brem
Jack turned to him, looking terribly amused. “Lead the way.”
The restaurant was warm and welcoming and Jack ordered a margarita and they all ordered fajitas and Brem nursed his iced tea.
“This salsa’s fabulous,” commented Jack.
“It’s why this place is great,” responded Kate.
“So let’s talk about Brem,” said Jack. “Do I need to give him tips on his kissing technique?”
Brem, who knew he was blushing furiously, considered what setting on the sonic screwdriver he could use on Jack under the table. He swore under his breath in Gallifreyan.
“Watch your language,” said Jack.
“You have no idea what I just said.”
“I know it was unpleasant.”
“Fancy that,” Brem rejoined.
“He’s good,” Kate said, openly amused. “No tips necessary. Tell me about Brem as a baby.”
“I didn’t know Brem as a baby, actually. I didn’t meet him until he was four. And by then he was, well, pretty much exactly the same as he is today, to be honest, only smaller.”
“Huh,” said Kate, sounding confused, and Brem looked at her questioningly. “I thought…” She looked back at Jack. “I thought Brem was named for you. But you didn’t meet him until he was four?”
“Oh,” said Jack. “Yeah, I…It’s a bit of a long story. I was…very good friends…with his parents…before Brem was born. And then we sort of…fell out of touch for a while.”
Kate nodded, although she still looked confused, and Brem knew she was wondering why his parents would have fallen out of touch with a person they thought highly enough of to name their son after.
“I was hoping for humiliating baby stories. How disappointing.” Kate grinned in Brem’s direction.
“I keep telling Kate I don’t have humiliating baby stories.”
“It’s true. Brem was 950 years old when he was born.”
“He looks good for it,” said Kate.
“Yeah, but not as good as me,” grinned Jack.
Kate laughed.
“I did get Brem drunk at his father’s stag night.”
Kate looked at Brem. “You were at your father’s stag night?”
“Oh. Yeah. My parents weren’t married until I was five. I mean, formally married. You know, an…Earth wedding.”
Kate smiled. “I’d expect nothing less from people who named their son after electromagnetic radiation.”
The mention of the stag night had reminded Brem of something, though. “Jack, tell her why you got me drunk.”
“Because he was cleaning up at poker.”
Brem shot Kate a triumphant look. “See? How good am I at bluffing, Jack?”
“Best bluffer in the universe. I don’t play with him anymore, I’ve learned my lesson.” Jack leaned back for the sizzling fajitas to arrive. “So how did the two of you meet?” he inquired. “Class?”
“Twentieth-Century Novel,” said Kate. “I spent six weeks trying to get him to notice me, then I told him he was wrong about something and that seemed to do the trick.”
Brem, his half-constructed fajita forgotten, looked at her. “Did you? Spend six weeks trying to get me to notice you?”
“You’re so impossibly cute,” Kate told him, and ruffled his hair.
“Telling him he’s wrong: it’s the way to all Gallifreyan hearts,” said Jack.
“What kind of hearts?” asked Kate.
“Complicated ones,” answered Brem, without missing a beat.
“So why are you in Boston?” Kate asked Jack.
“Recruiting.”
“For what?”
“He means ‘recruiting’ euphemistically,” Brem contributed.
“A euphemism for what?” asked Kate.
“Ignore Brem. I work for a government agency in the UK.”
“What sort of government agency?”
“I guess you would say homeland security, of a type.”
“Interesting,” Kate said. “Have you lived in the UK long?”
“Oh, yes,” Jack responded. “A very long time. Have you ever been?”
Kate shook her head.
Jack kept up the rest of the conversation with innocent talk about London sights to see, and Brem relaxed and enjoyed his fajita. Kate, who had eaten most of the chips and salsa, asked for half of her fajitas to be wrapped up to go. And just like that lunch was over and he’d survived.
“Back to campus?” asked Jack.
“Don’t you want to show Jack Tealuxe?” Kate inquired of Brem.
“Oh, I’m not much of a tea-drinker,” said Jack. “You two go and have fun.” Brem made a note to thank Jack later, as Jack took Kate’s hand and leaned over to kiss her cheek. “It was lovely to meet you, Kate.” He nodded his head toward Brem and said, playfully, “Careful with him. He’s a catch, you know.”
“Don’t I know it,” she replied, lightly. “Much too good to be true. And with relatives in national security. I’d better watch my step.”
Jack winked at her, turned to Brem, and ruffled his hair. “You. Get rid of this, kiddo.” He gestured between Brem’s eyebrows.
Brem frowned briefly, as Jack turned, deliberately flaring his coat out in a dramatic fashion.
“What did that mean?” Kate asked, taking his hand.
“They think I worry too much,” said Brem, dismissively.
“You do,” said Kate, and smoothed her index finger between his eyebrows.
“Mmm.” He was thinking of other things. “What do you think of Jack’s coat? D’you think I should get one?”
********
Kate was very stressed out. “Stress” was not a term used on the TARDIS. It was one of those peculiarly human things that the complicated, Gallifreyan sides of their nature didn’t seem to process. Stress? Whatever humans meant when they used that word, Brem wasn’t sure he knew, but he was fairly sure he had been stressed out the time he’d accidentally gotten separated from the rest of the family and through some huge misunderstanding had ended up sentenced to execution. He didn’t classify a biology exam and a topic-less term paper as constituting “stress.” But Kate did.
She had no topic.
“And I don’t have time to think of a topic,” she continued, shaking a sugar packet in preparation of dumping it into her cup of tea, “because I’ve got to study for an exam, in biology, which I still don’t understand.” Kate emptied the sugar into her tea and then replaced the cover over it. She had consented to leave the library for a Tealuxe break only if he took her back immediately. Brem had spent the entirety of this dreary, drizzly Saturday finishing a column, catching up in his journal, and rigging his sonic screwdriver to open and close the window blinds. He was bored out of his mind, but respecting Kate’s space and state of stress. He had only, as dinnertime approached, gone to the library to coax her out of it. She hadn’t eaten, and he’d convinced her that at least a cuppa was called for.
“I told you I’d help you with the biology,” he pointed out, as they headed out of Tealuxe.
“I’ve got an entire study group trying to teach me how to understand this stuff, Brem.”
“Yeah, an entire study group. Not me.”
Kate’s lips twitched a bit.
He saw the opportunity. “I’m Brem Tyler,” he reminded her, playfully bumping his shoulder against hers as they walked. “I’m good at everything.”
“I know,” she relented, smiling.
“Plus, if you let me teach you biology, I’ll reward you with a kiss every time you get an answer right.”
Kate laughed. “I don’t mean that you should teach me biology euphemistically, for a change.”
“And I’ll order a pizza.”
“Sold,” she said, and took his hand. “Have I been miserable to you this weekend?”
“Not at all. You’ve been…instructive.”
“Instructive?”
“I’m learning much about human stress.”
Kate shook her head at him and laughed, and he cajoled her back to his room, so they could order pizza and avoid Heather.
“Where’s Matt?” she asked.
He shrugged. “He’s holed himself up in the library, too. Apparently it’s the popular place to be these days.”
“It’s the time of year,” said Kate, throwing herself dramatically on his bed. “For everyone but you.”
He ignored her, ordering their pizza—cheese and pepperoni—and then turning to her as he sat at his desk. “What’s your test on?”
“Everything,” she said.
“That’s impossible. You can’t take a test on everything in biology, you lot haven’t even learned everything yet. Let me see your syllabus.”
Kate dug through her bag and handed it across to him solemnly. He glanced at it, taking the topics in quickly.
“Okay, what do you want to talk about first? DNA?”
“No, I get DNA.” “Then what do you need help on?”
“Protein synthesis.”
“Protein synthesis. Here we go. DNA contains the code for life. It's basically a string of nucleotides. The cell can copy that string when a cell replicates, or it can make a mirror image of it when it performs the process of transcription. RNA polymerase basically unzips a very specific section of DNA...the part that contains the code for the protein the organism needs. Using one strand of the DNA as a template, an mRNA strand is formed. It differs from DNA in that it is single-stranded and is composed of the nucleotides adenine, uracil, guanine and cytosine, rather than the adenine, thymine, guanine and cytosine of DNA. So, if a strand of DNA reads ATGGCTACG, the mRNA strand would read UACCGAUGC. The mRNA strand is released from the nucleus into the cytoplasm of the cell. Once in the cytoplasm, the mRNA strand is cleaned up. There are portions of your genetic code that are seemingly worthless, but it’s just that you haven’t figured out their purpose yet. These are called introns. The parts that code for a protein are called exons. The mature mRNA strand is now ready to be translated. Translation is the process of turning the nucleotides into amino acids. A ribosome binds to the mRNA. It facilitates the binding of tRNA to the mRNA strand. tRNA has a three-letter codon and an amino acid. So, if the mRNA strand looked like AUGUGGGAUCAUGUUACU then the tRNA molecule would look like UAC linked to methionine. It's like a lock and key. Only the tRNA with the correct anticodon can bind to the mRNA, and with it comes the proper amino acid. As the amino acids string together, a protein is formed.” Brem, who had been gesturing in the air to illustrate the unzipping process, dropped his hands. “Make sense?”
Brem ducked his head. “Does it?”
“No. You’re going to have to say all of it again. Only a bit more slowly than that. And maybe with diagrams.”
Brem sighed.
She grinned at him. “You really thought I was going to pick it up from that?”
“I don’t know. Maybe. Maybe you’d never had it explained that succinctly before.”
“Well, that’s definitely true. It usually takes us a couple of hours to describe protein synthesis.”
Brem grabbed a notebook and a pen off his desk and settled on the bed next to her. “Okay,” he said. “We’ll do this more slowly.”
“I’d appreciate that.” She ruffled his hair as he leaned over the notebook to draw a diagram for her.
It took her through the pepperoni pizza before she began to grasp what Brem’s overly detailed diagram was supposed to be. “Why can’t you just draw squares and lines like everyone else?” she asked, because his diagram was full of curly-cues and squiggles and elaborate codes. It was a little like his handwriting, which fascinated her, so full of flourishes and filigreed letters. Brem’s notes for class looked like eighteenth-century letters. She’d asked him where he’d learned to write like that, and he’d looked at her so blankly that she didn’t pursue the line of questioning.
“Because they don’t look like squares and lines,” he said, putting the leftover pizza, still in its box, into the fridge.
“Did you just fit that pizza box into that fridge?” asked Kate, staring at it.
“Yeah, it’s, uh…” He rubbed the back of his neck. “What about protein synthesis? Does it make more sense?” He settled back on the bed next to her.
“It makes more sense. It must be your fancy diagram here.”
“I’m sure its accuracy helps.”
“Also, your brilliance helps,” she teased him, nuzzling underneath his jaw.
“Yes,” he agreed, good-naturedly. “I’m going to quiz you.”
“Please do. It’s very adorable.” She settled her chin on his shoulder.
“If the DNA is TAGCCTAGTCATGCAGTTCATGGGCTA—“
“Brem. Let’s do one I have a chance of actually remembering.”
“Fine. If the DNA is TAG, the mRNA is?”
“AUC,” she answered, readily.
“Ah, well done,” he said in genuine delight, turning to look at her.
She went almost cross-eyed focusing on him so closely. “Thank you,” she said. “For teaching me protein synthesis.”
“One topic down. How many more to go?”
“Brem,” she groaned, closing her eyes.
“Right. First I promised to reward you with a kiss.”
“You did,” she agreed, and he closed the short distance between them, brushing his lips over hers. “I think we’ve earned a study break,” she murmured, adjusting their positions and brushing her hands through his hair.
“A bit of one,” he agreed.
“Mmm,” she sighed into the kiss.
The knock on the door barely registered with him, except it was immediately followed by the door opening and his sister saying, “Oh,” which did register with him. He pulled back abruptly and looked at her, standing in his doorway. “Athena.”
“Oh,” she said. “Sorry. Sorry. I—I’ll just—I—”
“This is my sister,” Brem said, anxiously, to Kate. “She really is. Just my sister. Before there are any misunderstandings. We are not sleeping together.”
“I can tell she’s your sister, Brem, she looks just like you,” Kate told him, amused, as she rose off the bed and leaned toward Athena. “I’m Kate,” she said, hand out.
“I’m Athena.” Athena shook it. “His sister. And what the hell has he done or said to make you think we would be sleeping together?” she inquired, in alarm.
Kate grinned. “It’s a long story. He can tell it. I was just leaving.”
“You clearly weren’t,” said Athena.
“I was.” She turned to Brem. “Visit with your sister. I really have to study, and you were distracting me.”
“I wasn’t doing anything,” he protested.
“Thanks for the protein synthesis. Really. I’ll call you tomorrow.” She leaned down to kiss him lightly, before moving past Athena. “It was nice meeting you,” she said, as she left.
“Yeah,” Athena responded, obviously still dazed, and then she turned to him. Brem ruffled his hair nervously. “You…” she began. “You have a…girlfriend.”
“Yeah,” said Brem. “Sort of. Well, yes. Yes. I do.”
Athena stared at him. “She’s…You didn’t tell me.”
“I…I…” He tugged at his earlobe. “Theenie—”
Athena sat on Matt’s bed and looked across at him. “She seems nice,” she cut him off.
“She is nice.”
“Tell me how you met her.”
“In class. In Twentieth-Century Novel. We were discussing The Great Gatsby, and she had this theory, about the American Dream.” Once started on the topic of Kate, Brem found he couldn’t stop. He wasn’t sure why he had wanted her kept secret, wanted her to be his and his alone, because now that he was sharing the fact of her with Athena, and Athena was making encouraging comments and laughing in the right places, he didn’t know why he’d thought Athena would mock him or somehow diminish the magic of Kate. He talked for hours about her. It would have been embarrassing had he realized it.
Matt walked in when the library closed, while Brem and Athena were finishing up ice cream they had fetched. He grunted hello, grabbed another textbook, and disappeared again.
“They’re all studying,” Brem informed Athena, licking at his spoon. “That’s what Kate and I were doing.”
“It didn’t look like that’s what Kate and you were doing,” teased Athena.
“Stop it,” mumbled Brem, blushing, as he looked down into his ice cream.
“What’s sex like without tentacles?” asked Athena, curiously.
Brem blushed more furiously, right to the roots of his hair, and said nothing.
“Oh,” said Athena. “You haven’t…”
“Can we not talk about it?” begged Brem, squirming.
“Sure. Absolutely.”
“Jack came to visit,” said Brem, to change the subject
“Jack? Why?”
“Check up on me. Annoy me. He’s got a great coat. I think my coat is not living up to my heritage.”
“Your coat is fine.”
“You don’t think it’s dull?”
“I think it’s fine, Brem. I should go.” She finished the last bite of her ice cream. “I don’t want to be missed. I snuck out on everyone this time.”
“Thanks for dropping by,” he said, standing up to walk her out.
“I interrupted you. I’ll try to give you advance warning next time.”
“Don’t worry about it.”
“I’d like to meet her, properly. Really. I wouldn’t scare her off or anything, Brem, I promise.”
“That isn’t why—” he began.
“I wish you’d told me. I mean, I wish you hadn’t felt like you couldn’t tell me. I wish—I mean, I would’ve been—”
“I don’t know why I kept it a secret,” he cut her off, because he felt awful about it now. She had clearly been hurt by this. “I just…It just felt like something I should…I wasn’t ready to tell people.”
She leaned forward suddenly and gave him a fierce hug, squeezing him tightly. He hugged her back.
“Okay,” she said, as she straightened and stepped back and gave him a bright smile. “Tell Kate I said good luck on her test.”
“Yeah,” he agreed. “Thanks for visiting, Theenie.”
“Oh, any time.” She waved him a cheerful good-bye, and he stood in the doorway of the dorm and watched until she located the teleport and vanished. |
|
Previous Entry · Leave a comment · Add to Memories · Share · Next Entry | |
This story is MADE OF ADORABLE. The Jack cameo was lovely and Brem's eye-bugging biology spiel was just absolutely hilarious and perfect. Man, I need a Brem to help with my finals. |
Athena's had sex with a tentacled alien? I mean, I know she's half alien, but tiem lords are humanoid and... *stares at her in disbelief* |
Brem sighed. “Is ‘recruiting’ a euphemism?” “Possibly,” said Jack, after a moment. *giggles* (that makes up more or less my entire thought process right now) |
I loved this chapter. The bit with Jack had me grinning so much my face hurt. And Athena is priceless. The "What's sex like without tentacles," line had me dying. |